resource source identifier antibodies rat anti mouse lyve (R&D Systems)
R&D Systems is a verified supplier 
R&D Systems manufactures this product 
94
Structured Review
R&D Systems
resource source identifier antibodies rat anti mouse lyve
Resource Source Identifier Antibodies Rat Anti Mouse Lyve, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+antibodies+rat+anti+mouse+lyve/Mouse+LYVE-1+PE-conjugated+Antibody/pm30463016-244-2-11
Average 94 stars, based on 33 article reviews
Resource Source Identifier Antibodies Rat Anti Mouse Lyve, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+antibodies+rat+anti+mouse+lyve/Mouse+LYVE-1+PE-conjugated+Antibody/pm30463016-244-2-11
Average 94 stars, based on 33 article reviews
resource source identifier antibodies rat anti mouse lyve - by Bioz Stars,
2026-09
94/100 stars
Images
Related Articles
Virus:Article Title: Cellular Barcoding Identifies Clonal Substitution as a Hallmark of Local Recurrence in a Surgical Model of Head and Neck Squamous Cell Carcinoma. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: RGB32_CD10hi/PElow (derived from RGB32) This paper N/A Human: RGB32_CD10hi/PEhi (derived from RGB32) This paper N/A Human: RGB32_CD10hi (derived from RGB32_CD10hi/ PElow and RGB32_CD10hi/PEhi) This paper N/A Human: RGB32_CD10low (derived from RGB32) This paper N/A Human: 673 (derived from RGB32_CD10hi) This paper N/A Human: 673R (derived from RGB32_CD10hi) This paper N/A Human: 677 (derived from RGB32_CD10hi) This paper N/A Human: cancer associated fibroblasts CAFs This paper N/A Human: immortalized cancer associated fibroblasts CAF-T (derived from CAFs) This paper N/A Experimental Models: Organisms/Strains Mouse: NMRI/Nude (female) JANVIER LABS RjOrl:NMRI-Foxn1nu /Foxn1nu Oligonucleotides MPLX-sPCR1: ACACTCTTTCCCTACACGACGCTC TTCCGATC-s-t This paper N/A MPLX-sPCR2: GTGACTGGAGTTCAGACGTGTGCTC TTCCGATC-s-t This paper N/A ZEB1-Q1F: TTACACCTTTGCATACAGAACCC This paper N/A ZEB1-Q2R: TTTACGATTACACCCAGACTGC This paper N/A SNAI2-Q1: CGAACTGGACACACATACAGTG This paper N/A SNAI2-Q2: CTGAGGATCTCTGGTTGTGGT This paper N/A GAPDH-Q1: ATGGGGAAGGTGAAGGTCG This paper N/A GAPDH-Q2: GGGGTCATTGATGGCAACAATA This paper N/A BarSeq-Sanger1: ACACTCTTTCCCTACACGAC This paper N/A BarSeq-Sanger2: GTGACTGGAGTTCAGACGTG This paper N/A Software and Algorithms Fiji Schindelin et al., 2012 https://fiji.sc/ R R Foundation for Statistical Computing https://www.R-project.org PRISM GraphPad https://www.graphpad.com Plasmid Preparation:Article Title: Cellular Barcoding Identifies Clonal Substitution as a Hallmark of Local Recurrence in a Surgical Model of Head and Neck Squamous Cell Carcinoma. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: RGB32_CD10hi/PElow (derived from RGB32) This paper N/A Human: RGB32_CD10hi/PEhi (derived from RGB32) This paper N/A Human: RGB32_CD10hi (derived from RGB32_CD10hi/ PElow and RGB32_CD10hi/PEhi) This paper N/A Human: RGB32_CD10low (derived from RGB32) This paper N/A Human: 673 (derived from RGB32_CD10hi) This paper N/A Human: 673R (derived from RGB32_CD10hi) This paper N/A Human: 677 (derived from RGB32_CD10hi) This paper N/A Human: cancer associated fibroblasts CAFs This paper N/A Human: immortalized cancer associated fibroblasts CAF-T (derived from CAFs) This paper N/A Experimental Models: Organisms/Strains Mouse: NMRI/Nude (female) JANVIER LABS RjOrl:NMRI-Foxn1nu /Foxn1nu Oligonucleotides MPLX-sPCR1: ACACTCTTTCCCTACACGACGCTC TTCCGATC-s-t This paper N/A MPLX-sPCR2: GTGACTGGAGTTCAGACGTGTGCTC TTCCGATC-s-t This paper N/A ZEB1-Q1F: TTACACCTTTGCATACAGAACCC This paper N/A ZEB1-Q2R: TTTACGATTACACCCAGACTGC This paper N/A SNAI2-Q1: CGAACTGGACACACATACAGTG This paper N/A SNAI2-Q2: CTGAGGATCTCTGGTTGTGGT This paper N/A GAPDH-Q1: ATGGGGAAGGTGAAGGTCG This paper N/A GAPDH-Q2: GGGGTCATTGATGGCAACAATA This paper N/A BarSeq-Sanger1: ACACTCTTTCCCTACACGAC This paper N/A BarSeq-Sanger2: GTGACTGGAGTTCAGACGTG This paper N/A Software and Algorithms Fiji Schindelin et al., 2012 https://fiji.sc/ R R Foundation for Statistical Computing https://www.R-project.org PRISM GraphPad https://www.graphpad.com Recombinant:Article Title: Cellular Barcoding Identifies Clonal Substitution as a Hallmark of Local Recurrence in a Surgical Model of Head and Neck Squamous Cell Carcinoma. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: RGB32_CD10hi/PElow (derived from RGB32) This paper N/A Human: RGB32_CD10hi/PEhi (derived from RGB32) This paper N/A Human: RGB32_CD10hi (derived from RGB32_CD10hi/ PElow and RGB32_CD10hi/PEhi) This paper N/A Human: RGB32_CD10low (derived from RGB32) This paper N/A Human: 673 (derived from RGB32_CD10hi) This paper N/A Human: 673R (derived from RGB32_CD10hi) This paper N/A Human: 677 (derived from RGB32_CD10hi) This paper N/A Human: cancer associated fibroblasts CAFs This paper N/A Human: immortalized cancer associated fibroblasts CAF-T (derived from CAFs) This paper N/A Experimental Models: Organisms/Strains Mouse: NMRI/Nude (female) JANVIER LABS RjOrl:NMRI-Foxn1nu /Foxn1nu Oligonucleotides MPLX-sPCR1: ACACTCTTTCCCTACACGACGCTC TTCCGATC-s-t This paper N/A MPLX-sPCR2: GTGACTGGAGTTCAGACGTGTGCTC TTCCGATC-s-t This paper N/A ZEB1-Q1F: TTACACCTTTGCATACAGAACCC This paper N/A ZEB1-Q2R: TTTACGATTACACCCAGACTGC This paper N/A SNAI2-Q1: CGAACTGGACACACATACAGTG This paper N/A SNAI2-Q2: CTGAGGATCTCTGGTTGTGGT This paper N/A GAPDH-Q1: ATGGGGAAGGTGAAGGTCG This paper N/A GAPDH-Q2: GGGGTCATTGATGGCAACAATA This paper N/A BarSeq-Sanger1: ACACTCTTTCCCTACACGAC This paper N/A BarSeq-Sanger2: GTGACTGGAGTTCAGACGTG This paper N/A Software and Algorithms Fiji Schindelin et al., 2012 https://fiji.sc/ R R Foundation for Statistical Computing https://www.R-project.org PRISM GraphPad https://www.graphpad.com Multiplex Assay:Article Title: Cellular Barcoding Identifies Clonal Substitution as a Hallmark of Local Recurrence in a Surgical Model of Head and Neck Squamous Cell Carcinoma. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: RGB32_CD10hi/PElow (derived from RGB32) This paper N/A Human: RGB32_CD10hi/PEhi (derived from RGB32) This paper N/A Human: RGB32_CD10hi (derived from RGB32_CD10hi/ PElow and RGB32_CD10hi/PEhi) This paper N/A Human: RGB32_CD10low (derived from RGB32) This paper N/A Human: 673 (derived from RGB32_CD10hi) This paper N/A Human: 673R (derived from RGB32_CD10hi) This paper N/A Human: 677 (derived from RGB32_CD10hi) This paper N/A Human: cancer associated fibroblasts CAFs This paper N/A Human: immortalized cancer associated fibroblasts CAF-T (derived from CAFs) This paper N/A Experimental Models: Organisms/Strains Mouse: NMRI/Nude (female) JANVIER LABS RjOrl:NMRI-Foxn1nu /Foxn1nu Oligonucleotides MPLX-sPCR1: ACACTCTTTCCCTACACGACGCTC TTCCGATC-s-t This paper N/A MPLX-sPCR2: GTGACTGGAGTTCAGACGTGTGCTC TTCCGATC-s-t This paper N/A ZEB1-Q1F: TTACACCTTTGCATACAGAACCC This paper N/A ZEB1-Q2R: TTTACGATTACACCCAGACTGC This paper N/A SNAI2-Q1: CGAACTGGACACACATACAGTG This paper N/A SNAI2-Q2: CTGAGGATCTCTGGTTGTGGT This paper N/A GAPDH-Q1: ATGGGGAAGGTGAAGGTCG This paper N/A GAPDH-Q2: GGGGTCATTGATGGCAACAATA This paper N/A BarSeq-Sanger1: ACACTCTTTCCCTACACGAC This paper N/A BarSeq-Sanger2: GTGACTGGAGTTCAGACGTG This paper N/A Software and Algorithms Fiji Schindelin et al., 2012 https://fiji.sc/ R R Foundation for Statistical Computing https://www.R-project.org PRISM GraphPad https://www.graphpad.com Derivative Assay:Article Title: Cellular Barcoding Identifies Clonal Substitution as a Hallmark of Local Recurrence in a Surgical Model of Head and Neck Squamous Cell Carcinoma. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: RGB32_CD10hi/PElow (derived from RGB32) This paper N/A Human: RGB32_CD10hi/PEhi (derived from RGB32) This paper N/A Human: RGB32_CD10hi (derived from RGB32_CD10hi/ PElow and RGB32_CD10hi/PEhi) This paper N/A Human: RGB32_CD10low (derived from RGB32) This paper N/A Human: 673 (derived from RGB32_CD10hi) This paper N/A Human: 673R (derived from RGB32_CD10hi) This paper N/A Human: 677 (derived from RGB32_CD10hi) This paper N/A Human: cancer associated fibroblasts CAFs This paper N/A Human: immortalized cancer associated fibroblasts CAF-T (derived from CAFs) This paper N/A Experimental Models: Organisms/Strains Mouse: NMRI/Nude (female) JANVIER LABS RjOrl:NMRI-Foxn1nu /Foxn1nu Oligonucleotides MPLX-sPCR1: ACACTCTTTCCCTACACGACGCTC TTCCGATC-s-t This paper N/A MPLX-sPCR2: GTGACTGGAGTTCAGACGTGTGCTC TTCCGATC-s-t This paper N/A ZEB1-Q1F: TTACACCTTTGCATACAGAACCC This paper N/A ZEB1-Q2R: TTTACGATTACACCCAGACTGC This paper N/A SNAI2-Q1: CGAACTGGACACACATACAGTG This paper N/A SNAI2-Q2: CTGAGGATCTCTGGTTGTGGT This paper N/A GAPDH-Q1: ATGGGGAAGGTGAAGGTCG This paper N/A GAPDH-Q2: GGGGTCATTGATGGCAACAATA This paper N/A BarSeq-Sanger1: ACACTCTTTCCCTACACGAC This paper N/A BarSeq-Sanger2: GTGACTGGAGTTCAGACGTG This paper N/A Software and Algorithms Fiji Schindelin et al., 2012 https://fiji.sc/ R R Foundation for Statistical Computing https://www.R-project.org PRISM GraphPad https://www.graphpad.com |